Journal: Medicine

Article Title: Method for discriminating synchronous multiple lung cancers of the same histological type

doi: 10.1097/MD.0000000000004478

Figure Lengend Snippet: The sum value of the differential expression (ΔΔCt) of 5 miRNAs in primary tumors and metastatic lymph nodes.

Article Snippet: Mature sequences of human miRNAs were as follows: hsa-miR-21-5p: 5′-UAGCUUAUCAGACUGAUGUUGA-3′ hsa-miR-30a-5p: 5′-UGUAAACAUCCUCGACUGGAAG-3′ hsa-miR-126-3p: 5′-UCGUACCGUGAGUAAUAAUGCG-3′ hsa-miR-129-5p: 5′-CUUUUUGCGGUCUGGGCUUGC-3′ hsa-miR-182-5p: 5′-UUUGGCAAUGGUAGAACUCACACU-3′ First-strand cDNA was synthesized using a miRcute miRNA first-strand cDNA synthesis kit (Tiangen Biotech) with an Escherichia coli poly(A) polymerase and oligo (dT)-universal primer.

Techniques: Quantitative Proteomics

Journal: Medicine

Article Title: Method for discriminating synchronous multiple lung cancers of the same histological type

doi: 10.1097/MD.0000000000004478

Figure Lengend Snippet: The sum value of the differential expression (ΔΔCt) of 5 miRNAs in synchronous multiple lung cancers (SMLCs). “A” represented as newly classified metastasis by miRNA criteria, and “B” represented as newly classified SMPLCs by miRNA criteria. miRNA = microRNA; SMLCs = synchronous multiple lung cancers.

Article Snippet: Mature sequences of human miRNAs were as follows: hsa-miR-21-5p: 5′-UAGCUUAUCAGACUGAUGUUGA-3′ hsa-miR-30a-5p: 5′-UGUAAACAUCCUCGACUGGAAG-3′ hsa-miR-126-3p: 5′-UCGUACCGUGAGUAAUAAUGCG-3′ hsa-miR-129-5p: 5′-CUUUUUGCGGUCUGGGCUUGC-3′ hsa-miR-182-5p: 5′-UUUGGCAAUGGUAGAACUCACACU-3′ First-strand cDNA was synthesized using a miRcute miRNA first-strand cDNA synthesis kit (Tiangen Biotech) with an Escherichia coli poly(A) polymerase and oligo (dT)-universal primer.

Techniques: Quantitative Proteomics

Journal: Acta Neuropathologica

Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates

doi: 10.1007/s00401-013-1217-3

Figure Lengend Snippet: Expression of EGFRvIII as a fraction of total EGFR is quantified by Nanostring assay and qRT-PCR in 189 GBMs. a Expression of EGFRvIII (exon 1–8 junctional probe) is shown as a function of EGFR kinase domain ( KD ), determined by normalized Nanostring ( NS ) counts. Expression levels are classified as high [ red mutation in >10 % transcribed allelic fraction ( TAF )], intermediate ( orange 1–10 % TAF), marginal ( black <1 % TAF) or negative ( open circles ). These color assignments are carried through panels b – d . b Correlation of EGFRvIII expression between NS and qRT-PCR. Normalized expression levels are plotted for EGFRvIII and KD from the Taqman assay (see “ ”). Samples are colored according to NS expression classification from Fig. 1a. c Cross-platform correlation of EGFRvIII epression, NS vs. qRT-PCR. d Cross-platform correlation of EGFRvIII as a fraction of total EGFR, NS vs. qRT-PCR. e Experimental design of dilution experiment to establish linearity of the Nanostring assay. A sample with high relative expression of EGFRvIII was diluted with a sample negative for EGFRvIII expression, maintaining a constant 250 ng of total RNA in each reaction. f Counts of EGFRvIII and EGFR KD as a function of diluted fraction of EGFRvIII-containing sample

Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan ABI Gene expression Assays Hs01076076_m1).

Techniques: Expressing, Quantitative RT-PCR, Mutagenesis, TaqMan Assay

Journal: Acta Neuropathologica

Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates

doi: 10.1007/s00401-013-1217-3

Figure Lengend Snippet: Comparison with orthogonal platforms a EGFRvIII vs. total EGFR as determined by Nanostring is plotted. EGFRvIII expression was determined independently from TCGA RNA-seq analysis (RNAS). Red denotes cases with >10 % TAF by RNAS, green 1–10 % and blue <1 %. Black circles filled with gray mark cases where no RNAS reads identified EGFRvIII; empty circles mark cases for which RNA-seq data were unavailable. b EGFRvIII expression was compared with genomic loss of EGFR exons 2–7 in 157 cases for which both RNA and DNA (exome) sequencing data were available. Samples are ordered by the magnitude of exon 2–7 deletion inferred from DNA seq coverage. Expression was determined by the ratio of VIII junction RPKM to total EGFR

Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan ABI Gene expression Assays Hs01076076_m1).

Techniques: Comparison, Expressing, RNA Sequencing, Sequencing, DNA Sequencing

Journal: Acta Neuropathologica

Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates

doi: 10.1007/s00401-013-1217-3

Figure Lengend Snippet: Performance of Nanostring assay applied to suboptimal material. Counts of EGFR-WT ( a ) and EGFRvIII ( b ) are correlated between patient-matched samples maintained by optimal, flash-frozen, and suboptimal, versus formalin-fixed paraffin-embedded samples ( FFPE ), preservation methods. c Concordance of NS assay as a binary classifier from FFPE and frozen material

Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan ABI Gene expression Assays Hs01076076_m1).

Techniques: Formalin-fixed Paraffin-Embedded, Preserving

Journal: Acta Neuropathologica

Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates

doi: 10.1007/s00401-013-1217-3

Figure Lengend Snippet: Genomic and clinical correlates of EGFRvIII expression. a Significant EGFRvIII expression is exclusively found in tumors with amplification of EGFR. NS counts of EGFRvIII expression are plotted with respect to kinase domain counts. Blue circles denote samples with EGFR point mutation. Red denotes tumors with high-level amplification of the EGFR locus (aCGH log2 ratio >2). For two samples with high EGFRvIII expression, but log2 ratios below 2 ( red arrows ), aCGH demonstrates focal CNA in a pattern consistent with high-level gene amplification in a subpopulation of cells (and demonstrated by FISH for one of the two cases ). b Association between EGFR status and transcriptomal subclass. c Overall survival of patients stratified by EGFRvIII status. d Overall survival of patients stratified by EGFRvIII status excluding G-CIMP tumors, which are known to have a more favorable prognosis

Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan ABI Gene expression Assays Hs01076076_m1).

Techniques: Expressing, Amplification, Mutagenesis

Journal: Acta Neuropathologica

Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates

doi: 10.1007/s00401-013-1217-3

Figure Lengend Snippet: Molecular context of EGFR alterations in GBM. From top to bottom EGFR mRNA expression, DNA copy number, deletion mutation expression, transcriptomal and methylation subclass are reported for each sample

Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan ABI Gene expression Assays Hs01076076_m1).

Techniques: Expressing, Mutagenesis, Methylation

Journal: Oncotarget

Article Title: Imprinting defects at human 14q32 locus alters gene expression and is associated with the pathobiology of osteosarcoma.

doi: 10.18632/oncotarget.6965

Figure Lengend Snippet: Figure 3: Downregulation of genes by imprinting defects at the 14q32-locus. (A) 14q index (14q-I) of four normal bone tissue samples, six 14q-I(−) osteosarcoma and eight 14q-I(+) osteosarcoma samples. (B) mRNA levels of six imprinted genes by qRT-PCR with GAPDH used as control. The right column indicates the average and standard error of the imprinted gene expression levels in 3 different groups, including normal bone tissues, 14q-I(−) osteosarcoma and 14q-I(+) osteosarcoma groups, respectively. *P < 0.05. (C) Relative expression levels of representative DLK1-DIO3 cluster mRNAs and 14q32 miRNAs from an independent cohort of 43 osteosarcoma patient samples.

Article Snippet: Human DLK1 overexpression plasmid was obtained from Origene.

Techniques: Quantitative RT-PCR, Control, Gene Expression, Expressing

Journal: Oncotarget

Article Title: Imprinting defects at human 14q32 locus alters gene expression and is associated with the pathobiology of osteosarcoma.

doi: 10.18632/oncotarget.6965

Figure Lengend Snippet: Figure 4: Histone modifications around imprinted genes and their potential tumor suppressor functions at the 14q32- locus. (A) Enrichment of H3, H3K4-me3, H3K27-me3, H3K9-me2 and H3K9-me3 at the promoter regions of imprinted genes in normal bone tissues. Input was used as internal control. Up-5kb: site ~5 kb upstream of the promoter of DLK1; SNO: small non coding RNA region; CIT: miRNA cluster 3 region. (B) H3K4-me3, H3K27-me3, H3K9-me2 and H3K9-me3 enrichment normal bone tissues, 14q-I(−) and 14q-I(+) osteosarcoma samples. H3 was used as internal control. *P < 0.05. (C) DNA methylation levels of the ChIP samples pulled down by H3, H3K4-me3, and H3K27-me3 antibodies in normal bone tissues, 14q-I(−) osteosarcoma and 14q-I(+) osteosarcoma samples. Input sample was used as control. (D) Significant decrease of cell viability by overexpression of DIO3, DLK1 and RTL1 in SaOS2 cells. Paired t-test was performed. *P < 0.05. (E) Increased apoptosis by overexpression of DIO3, DLK1 and RTL1 in SaOS2 cells. pCDNA3.1 empty vector was used as control. Sham represents SaOS2 cells without plasmid transfection. Results represent the average of three independent transfections. *P < 0.05.

Article Snippet: Human DLK1 overexpression plasmid was obtained from Origene.

Techniques: Control, DNA Methylation Assay, Over Expression, Plasmid Preparation, Transfection

Journal: World Journal of Gastrointestinal Surgery

Article Title: Research progress on O-GlcNAcylation in the occurrence, development, and treatment of colorectal cancer

doi: 10.4240/wjgs.v13.i2.96

Figure Lengend Snippet: Summary of Studies on O-GlcNAcylation and colorectal cancer in recent 5 years

Article Snippet: Liu et al [ ] , 2019 , (1) The human CRC cell lines HCT116 and SW480. (2) The human embryonic kidney cells HEK293T. And (3) The human CRC cells LS174T (Tn-positive) , (1) American Type Culture Collection (ATCC). And (2) Dr. Tongzhong Ju of the Emory University School of Medicine, Atlanta, United States , (1) CRISPR/Cas9-mediated knockout of COSMC chaperone. (2) Flow cytometry. (3) Cell migration and invasion assays. (4) Establishment of transplantable metastatic murine models. (5) IHC. (6) Knockdown of H-Ras with shRNA. (7) Re-expression of COSMC in LS174T cells. (8) RNA extraction and qRT-PCR. (9) WB and antibodies. And (10) TCGA colon cancer dataset , Tn antigen expression (a marker of abnormal O-GlcNAcylation) may promote EMT activation by upregulation of h-RAS, possibly leading to CRC metastasis. It also suggests that anti-Tn antigen has a great prospect in tumor immunotherapy.

Techniques: Glycoproteomics, Quantitative Proteomics, Plasmid Preparation, Transfection, Isolation, Purification, RNA Extraction, Protein Extraction, Western Blot, Flow Cytometry, Biomarker Discovery, Expressing, Migration, Immunofluorescence, Confocal Microscopy, Invasion Assay, Co-culture Assay, Gene Expression, Chromatin Immunoprecipitation, Construct, CRISPR, Knock-Out, Knockdown, shRNA, Marker, Activation Assay, Labeling, Microarray, Immunohistochemistry-IF, Activity Assay, Soft Agar Assay, Ligation, In Vitro, Cell Culture, Stable Transfection, CCK-8 Assay, Virus, Reporter Assay, Reverse Transcription, Viability Assay, Colony Assay, Cell Migration Assay, Infection, Microscopy, Mutagenesis, Immunohistochemical staining, Staining, Sequencing, DNA Methylation Assay, Mass Spectrometry, Multiplex Assay, Immunohistochemistry, Proteomic Assay, Affinity Purification, Motility Assay, Luciferase, In Vivo, Fluorescence, In Situ Hybridization, Sample Prep, Concentration Assay, Chemotaxis Assay, Extraction, Bacteria, Adjuvant, Histopathology, Cell Adhesion Assay, Colorimetric Assay

Journal: World Journal of Gastrointestinal Surgery

Article Title: Research progress on O-GlcNAcylation in the occurrence, development, and treatment of colorectal cancer

doi: 10.4240/wjgs.v13.i2.96

Figure Lengend Snippet: Gene targets associated with O-GlcNAcylation in colorectal cancer

Article Snippet: Liu et al [ ] , 2019 , (1) The human CRC cell lines HCT116 and SW480. (2) The human embryonic kidney cells HEK293T. And (3) The human CRC cells LS174T (Tn-positive) , (1) American Type Culture Collection (ATCC). And (2) Dr. Tongzhong Ju of the Emory University School of Medicine, Atlanta, United States , (1) CRISPR/Cas9-mediated knockout of COSMC chaperone. (2) Flow cytometry. (3) Cell migration and invasion assays. (4) Establishment of transplantable metastatic murine models. (5) IHC. (6) Knockdown of H-Ras with shRNA. (7) Re-expression of COSMC in LS174T cells. (8) RNA extraction and qRT-PCR. (9) WB and antibodies. And (10) TCGA colon cancer dataset , Tn antigen expression (a marker of abnormal O-GlcNAcylation) may promote EMT activation by upregulation of h-RAS, possibly leading to CRC metastasis. It also suggests that anti-Tn antigen has a great prospect in tumor immunotherapy.

Techniques: Expressing, Activation Assay, Translocation Assay